|
Marker Overview
Name | Ca-II-SSR0001 |
Genbank ID | N/A |
Type | SSR |
Species | Cicer arietinum |
Repeat Motif | (TG)11 |
Primer 1 | Ca-II-SSR0001.Forward: TCGGTTCCAACAAATTACGG |
Primer 2 | Ca-II-SSR0001.Reverse: TGCAAATTCTCCATCACCTG |
Publication | [view all] |
Contact | Swarup Parida
|
Alignments
The following features are aligned
Publications
Year | Publication |
2015 | Bajaj D, Upadhyaya HD, Khan Y, Das S, Badoni S, Shree T, Kumar V, Tripathi S, Gowda CLL, Singh S, Sharma S, Tyagi AK, Chattopdhyay D, Parida SK. A combinatorial approach of comprehensive QTL-based comparative genome mapping and transcript profiling identified a seed weight-regulating candidate gene in chickpea. Scientific Reports. 2015; 5:9264. |
|