GO660522

EST Overview
NameGO660522
Unique NameGO660522
TypeEST
OrganismCicer arietinum (chickpea)
Sequence length164
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Cicer arietinum unigene v12010-12-27
Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Cicer arietinum unigene v1Cicer arietinum unigene v1EST
Properties
Property NameValue
Singlet in analysisCicer arietinum unigene v1
Sequences
The following sequences are available for this feature:

EST sequence

>GO660522 ID=GO660522|Name=GO660522|organism=Cicer arietinum|type=EST|length=164bp
TGACTGCGTACCAATTCAACACCTTCAGCTGCAAAAACTTTCAGAACATC
AAAGCTATCAACATATTCAGCTTCAAAATTCAGCCCTGCCATAGGAGCCT
AAAAAAAACAGATGTAATCTTCTCTTCTTTACAAGCTTTCTTGAAACTTG
TTACTCAGGACTCA
back to top