GO660523

EST Overview
NameGO660523
Unique NameGO660523
TypeEST
OrganismCicer arietinum (chickpea)
Sequence length223
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Cicer arietinum unigene v12010-12-27
Relationships

This EST is a part of the following contig feature(s):

Feature NameUnique NameSpeciesType
Cicer_arietinum_v1_Contig1721Cicer_arietinum_v1_Contig1721Cicer arietinumcontig


Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Cicer arietinum unigene v1Cicer arietinum unigene v1EST
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Cicer_arietinum_v1_Contig1721contigCicer_arietinum_v1_Contig1721:1..160 -
Properties
Property NameValue
Actual start-62
Sequences
The following sequences are available for this feature:

EST sequence

>GO660523 ID=GO660523|Name=GO660523|organism=Cicer arietinum|type=EST|length=223bp
ATCTCTTCGTAACGTTCGGCTTGTTCGGCGAGTTTCGCCATGTAGACGAA
CTCTTCGCGTGGTGTTGGTGCGGTTGCCATCGAGGAATCTGTGTGCGGAA
TCGGAGAGAGAGAGTGAAAGGGAAAGGAAGAAAATAGAGAGAGAAAGTCT
ACAAAGGGTGGATGGGAATGAGATGAAGAAATCAAGAAATAAGCGGTTTT
TGGTTTTAGTGGATGGTGGGGTG
back to top