GO660556

EST Overview
NameGO660556
Unique NameGO660556
TypeEST
OrganismCicer arietinum (chickpea)
Sequence length372
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
Cicer arietinum unigene v12010-12-27
Relationships

This EST is a part of the following contig feature(s):

Feature NameUnique NameSpeciesType
Cicer_arietinum_v1_Contig1184Cicer_arietinum_v1_Contig1184Cicer arietinumcontig


Unigenes
This EST is part of the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
Cicer arietinum unigene v1Cicer arietinum unigene v1EST
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Cicer_arietinum_v1_Contig1184contigCicer_arietinum_v1_Contig1184:300..671 +
Sequences
The following sequences are available for this feature:

EST sequence

>GO660556 ID=GO660556|Name=GO660556|organism=Cicer arietinum|type=EST|length=372bp
CACAACAAGGGAGGATATTGCTATTGTGCTGATTAGCCAATTTGTTGCAA
ATATGATAAGGTTTTTGGTTGATAGTTATAACAAGCCTGTTCCTGCAATA
CTTGAAATCCCATCCAAAGACCACCCTTATGATCCCGCGCATGATTCAGT
TCTTTCACGAGTGAAGTATCTCTTCTCTGCTGAATCAGTGGCTTCTGATA
GACGCTGAATCACCCTTGTTTCGCGGCAGCTTTTGGGCGTTTGTTGTTCT
TTTTTTGTACATTATGGCCAATAATCTTCACTTGAAATTCATGAGTTCTA
TGTAGCTTGAATAATTTGTACTGTTTGGTTGTAATTTGAAAATCCTGTGA
TAGATCTTCAAGATGGGCTGAT
back to top