AB025002, AB025002 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	AB025002
Genbank ID	AB025002
Type	CAPS
Species	Cicer sp.
Primer 1	AB025002.Forward primer: TTCCTCGATCATGTCGAACTT
Primer 2	AB025002.Reverse primer: CGTGCACCAGCTTCGTAGTA
Restriction Enzyme	EcoR V
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	AB025002

Publications


Year	Publication
2010	Nayak SN, Zhu H, Varghese N, Datta S, Choi H, Horres R, Jüngling R, Singh J, Kavi Kishor PB, Sivaramakrishnan S, Hoisington DA, Kahl G, Winter P, Cook DR, Varshney RK. Integration of novel SSR and gene-based SNP marker loci in the chickpea genetic map and establishment of new anchor points with Medicago truncatula genome. Theoretical and applied genetics TAG. 2010; 120(7):1415-1441.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2011	LG2	N/A	59.6	AB025002	View
2	chickpea-ICC4958xPI489777-RIL-F10	LG2	N/A	52.49	AB025002	View
3	chickpea-ICC4958xPI489777-RIL-F10-2012	LG02	N/A	50.33	AB025002	View
4	chickpea-ICC4958xPI489777-RIL-2010	LG2	N/A	124.6	AB025002	View