CaGMS1445, CaGMS1445 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	CaGMS1445
Genbank ID	N/A
Type	SSR
Species	Cicer sp.
Repeat Motif	(TA)11
Primer 1	CaGMS1445.Forward primer: GGAAATGAGCTGAAATTCCTGT
Primer 2	CaGMS1445.Reverse primer: TGGCCTTATTGATCTCCaCA
Product Length	205
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Ca6	chromosome	Ca6:12855966..12856166 .	Cicer arietinum CDC Frontier genome v1.0	PCD marker alignment to genome using primer sequences
chr6	chromosome	chr6:12855966..12856166 .	Cicer arietinum CDC Frontier NCBI RefSeq v1	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2015	Khajuria YP, Saxena MS, Gaur R, Chattopadhyay D, Jain M, Parida SK, Bhatia S. Development and Integration of Genome-Wide Polymorphic Microsatellite Markers onto a Reference Linkage Map for Constructing a High-Density Genetic Map of Chickpea. PloS one. 2015; 10(5):e0125583.