CaGMS1491, CaGMS1491 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	CaGMS1491
Genbank ID	N/A
Type	SSR
Species	Cicer sp.
Repeat Motif	(AT)11
Primer 1	CaGMS1491.Forward primer: aGAAACATTATGAACACAACAATGA
Primer 2	CaGMS1491.Reverse primer: CAGTTTGGCAAAAGTTAATTTCC
Product Length	280
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Ca2	chromosome	Ca2:25194198..25194476 .	Cicer arietinum CDC Frontier genome v1.0	PCD marker alignment to genome using primer sequences
chr2	chromosome	chr2:25194198..25194476 .	Cicer arietinum CDC Frontier NCBI RefSeq v1	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2015	Khajuria YP, Saxena MS, Gaur R, Chattopadhyay D, Jain M, Parida SK, Bhatia S. Development and Integration of Genome-Wide Polymorphic Microsatellite Markers onto a Reference Linkage Map for Constructing a High-Density Genetic Map of Chickpea. PloS one. 2015; 10(5):e0125583.