CaGMS31, CaGMS31 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	CaGMS31
Genbank ID	N/A
Type	SSR
Species	Cicer sp.
Repeat Motif	(AT)13
Primer 1	CaGMS31.Forward primer: GGGATGCATCTGCAAATTTTA
Primer 2	CaGMS31.Reverse primer: TGAGTCCAATAAAACCCCCA
Product Length	249
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Ca1	chromosome	Ca1:30671033..30671280 .
chr1	chromosome	chr1:30671033..30671280 .

Publications


Year	Publication
2015	Khajuria YP, Saxena MS, Gaur R, Chattopadhyay D, Jain M, Parida SK, Bhatia S. Development and Integration of Genome-Wide Polymorphic Microsatellite Markers onto a Reference Linkage Map for Constructing a High-Density Genetic Map of Chickpea. PloS one. 2015; 10(5):e0125583.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2015	LG1	N/A	53.85	CaGMS31	View
2	chickpea-ICC4958xPI489777-RIL-2015-2	LG1	N/A	50.8	CaGMS31	View
3	Chickpea-ICC4958/PI489777-RIL-2020	LG01	N/A	55.96	CaGMS31	View