CaGMS433, CaGMS433 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	CaGMS433
Genbank ID	N/A
Type	SSR
Species	Cicer sp.
Repeat Motif	(AT)10
Primer 1	CaGMS433.Forward primer: ATTTGAAGAGCTCCGTCCAC
Primer 2	CaGMS433.Reverse primer: TGAAAACGTGGAACATCCAA
Product Length	168
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Ca7	chromosome	Ca7:4722735..4722900 .
chr7	chromosome	chr7:4722735..4722900 .

Publications


Year	Publication
2015	Khajuria YP, Saxena MS, Gaur R, Chattopadhyay D, Jain M, Parida SK, Bhatia S. Development and Integration of Genome-Wide Polymorphic Microsatellite Markers onto a Reference Linkage Map for Constructing a High-Density Genetic Map of Chickpea. PloS one. 2015; 10(5):e0125583.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2015	LG1	N/A	14.38	CaGMS433	View
2	chickpea-ICC4958xPI489777-RIL-2015-2	LG1	N/A	14.7	CaGMS433	View
3	Chickpea-ICC4958/PI489777-RIL-2020	LG01	N/A	14.7	CaGMS433	View