CaTMS1093, CaTMS1093 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	CaTMS1093
Genbank ID	N/A
Type	SSR
Species	Cicer sp.
Repeat Motif	(AT)14
Primer 1	CaTMS1093.Forward primer: AGTGCCTTTTGCATACACACA
Primer 2	CaTMS1093.Reverse primer: CTGGTTGGGAGAATTTTTGC
Product Length	198
Publication	[view all]

Publications


Year	Publication
2015	Khajuria YP, Saxena MS, Gaur R, Chattopadhyay D, Jain M, Parida SK, Bhatia S. Development and Integration of Genome-Wide Polymorphic Microsatellite Markers onto a Reference Linkage Map for Constructing a High-Density Genetic Map of Chickpea. PloS one. 2015; 10(5):e0125583.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2015	LG3	N/A	42.43	CaTMS1093	View
2	chickpea-ICC4958xPI489777-RIL-2015-2	LG8	N/A	116.3	CaTMS1093	View
3	Chickpea-ICC4958/PI489777-RIL-2020	LG08	N/A	116.69	CaTMS1093	View