CaTMS594, CaTMS594 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	CaTMS594
Genbank ID	N/A
Type	SSR
Species	Cicer sp.
Repeat Motif	(CTA)6
Primer 1	CaTMS594.Forward primer: AGACATCCACCACCACCATT
Primer 2	CaTMS594.Reverse primer: TGGAGAGGATCCATAGCAGG
Product Length	260
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Ca6	chromosome	Ca6:29196485..29196744 .
chr6	chromosome	chr6:29196485..29196744 .

Publications


Year	Publication
2015	Khajuria YP, Saxena MS, Gaur R, Chattopadhyay D, Jain M, Parida SK, Bhatia S. Development and Integration of Genome-Wide Polymorphic Microsatellite Markers onto a Reference Linkage Map for Constructing a High-Density Genetic Map of Chickpea. PloS one. 2015; 10(5):e0125583.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2015	LG1	N/A	103.69	CaTMS594	View
2	chickpea-ICC4958xPI489777-RIL-2015-2	LG4	N/A	86.44	CaTMS594	View
3	Chickpea-ICC4958/PI489777-RIL-2020	LG04	N/A	126.54	CaTMS594	View