CaTMS603, CaTMS603 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	CaTMS603
Genbank ID	N/A
Type	SSR
Species	Cicer sp.
Repeat Motif	(TAT)6
Primer 1	CaTMS603.Forward primer: CAAAAGGGCGTTAAGGTTCA
Primer 2	CaTMS603.Reverse primer: GGAACCCTATGGTTTCCGA
Product Length	271
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Ca3	chromosome	Ca3:21471089..21471359 .	Cicer arietinum CDC Frontier genome v1.0	PCD marker alignment to genome using primer sequences
chr3	chromosome	chr3:21471089..21471359 .	Cicer arietinum CDC Frontier NCBI RefSeq v1	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2015	Khajuria YP, Saxena MS, Gaur R, Chattopadhyay D, Jain M, Parida SK, Bhatia S. Development and Integration of Genome-Wide Polymorphic Microsatellite Markers onto a Reference Linkage Map for Constructing a High-Density Genetic Map of Chickpea. PloS one. 2015; 10(5):e0125583.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2015	LG8	N/A	53.72	CaTMS603	View
2	chickpea-ICC4958xPI489777-RIL-2015-2	LG8	N/A	91.27	CaTMS603	View
3	Chickpea-ICC4958/PI489777-RIL-2020	LG08	N/A	117.48	CaTMS603	View