CaTMS826, CaTMS826 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	CaTMS826
Genbank ID	N/A
Type	SSR
Species	Cicer sp.
Repeat Motif	(GA)10
Primer 1	CaTMS826.Forward primer: CTGGTCCAAAGATCACAGCA
Primer 2	CaTMS826.Reverse primer: CTTTCACCCCCACAAACACT
Product Length	240
Publication	[view all]

Publications


Year	Publication
2015	Khajuria YP, Saxena MS, Gaur R, Chattopadhyay D, Jain M, Parida SK, Bhatia S. Development and Integration of Genome-Wide Polymorphic Microsatellite Markers onto a Reference Linkage Map for Constructing a High-Density Genetic Map of Chickpea. PloS one. 2015; 10(5):e0125583.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2015	LG3	N/A	40.72	CaTMS826	View
2	chickpea-ICC4958xPI489777-RIL-2015-2	LG8	N/A	118	CaTMS826	View
3	Chickpea-ICC4958/PI489777-RIL-2020	LG08	N/A	118.53	CaTMS826	View