CaTMS868, CaTMS868 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	CaTMS868
Genbank ID	N/A
Type	SSR
Species	Cicer sp.
Repeat Motif	(TGA)5
Primer 1	CaTMS868.Forward primer: ATGTGCGAAGAAGAAGCACA
Primer 2	CaTMS868.Reverse primer: AGGTGGATCACTTGTTTGCC
Product Length	104
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
scaffold1348_1	supercontig	scaffold1348_1:104368..104471 .
scaffold1348_1	chromosome	scaffold1348_1:104368..104471 .

Publications


Year	Publication
2015	Khajuria YP, Saxena MS, Gaur R, Chattopadhyay D, Jain M, Parida SK, Bhatia S. Development and Integration of Genome-Wide Polymorphic Microsatellite Markers onto a Reference Linkage Map for Constructing a High-Density Genetic Map of Chickpea. PloS one. 2015; 10(5):e0125583.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2015	LG1	N/A	75.35	CaTMS868	View
2	chickpea-ICC4958xPI489777-RIL-2015-2	LG1	N/A	69.91	CaTMS868	View
3	Chickpea-ICC4958/PI489777-RIL-2020	LG01	N/A	76.29	CaTMS868	View