CaTMS923, CaTMS923 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	CaTMS923
Genbank ID	N/A
Type	SSR
Species	Cicer sp.
Repeat Motif	(AAT)28
Primer 1	CaTMS923.Forward primer: TCCAGAAAGAGGTCAACAAGG
Primer 2	CaTMS923.Reverse primer: TCACAAACATCAAAATGCGG
Product Length	258
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Ca4	chromosome	Ca4:43315891..43316111 .
chr4	chromosome	chr4:43315891..43316111 .

Publications


Year	Publication
2015	Khajuria YP, Saxena MS, Gaur R, Chattopadhyay D, Jain M, Parida SK, Bhatia S. Development and Integration of Genome-Wide Polymorphic Microsatellite Markers onto a Reference Linkage Map for Constructing a High-Density Genetic Map of Chickpea. PloS one. 2015; 10(5):e0125583.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2015	LG8	N/A	10.3	CaTMS923	View
2	chickpea-ICC4958xPI489777-RIL-2015-2	LG8	N/A	116.9	CaTMS923	View
3	Chickpea-ICC4958/PI489777-RIL-2020	LG08	N/A	118.56	CaTMS923	View