CGMM012, CGMM012 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	CGMM012
Genbank ID	CK148968
Type	CAPS
Species	Cicer sp.
Primer 1	CGMM012.Forward primer: GTCCAGTTCGCCCAATTCTA
Primer 2	CGMM012.Reverse primer: ATGGAAGGCCGTGTCAATAA
Product Length	500
Restriction Enzyme	ApoI
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	CK148968

Publications


Year	Publication
2011	Gujaria N, Kumar A, Dauthal P, Dubey A, Hiremath P, Bhanu Prakash A, Farmer A, Bhide M, Shah T, Gaur PM, Upadhyaya HD, Bhatia S, Cook DR, May GD, Varshney RK. Development and use of genic molecular markers (GMMs) for construction of a transcript map of chickpea (Cicer arietinum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2011 May; 122(8):1577-89.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2011	LG2	N/A	44	CGMM012	View
2	chickpea-ICC4958xPI489777-RIL-F10	LG2	N/A	38.84	CGMM012	View
3	chickpea-ICC4958xPI489777-RIL-F10-2012	LG02	N/A	42.13	CGMM012	View