CGMM026, CGMM026 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	CGMM026
Genbank ID	HO214223
Type	CAPS
Species	Cicer sp.
Primer 1	CGMM026.Forward primer: ATGGGTGCAGGTTTCATAGC
Primer 2	CGMM026.Reverse primer: TGAAGCAGAGCACTTTGTGG
Product Length	850
Restriction Enzyme	HpyCH4III
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	HO214223

Publications


Year	Publication
2011	Gujaria N, Kumar A, Dauthal P, Dubey A, Hiremath P, Bhanu Prakash A, Farmer A, Bhide M, Shah T, Gaur PM, Upadhyaya HD, Bhatia S, Cook DR, May GD, Varshney RK. Development and use of genic molecular markers (GMMs) for construction of a transcript map of chickpea (Cicer arietinum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2011 May; 122(8):1577-89.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-F10	LG5	N/A	33.32	CGMM026	View