|
|
Marker Overview
| Name | CGMM111 |
|---|
| Genbank ID | N/A |
|---|
| Type | CAPS |
|---|
| Species | Cicer sp. |
|---|
| Primer 1 | CGMM111.Forward primer: TGGAGACATGGACCAAAACA |
|---|
| Primer 2 | CGMM111.Reverse primer: AGGCAACTCCTCTACGGTCA |
|---|
| Product Length | 300 |
|---|
| Restriction Enzyme | NcoI |
|---|
| Publication | [view all] |
|---|
Publications
| Year | Publication |
|---|
| 2009 | Varshney RK, Hiremath PJ, Lekha P, Kashiwagi J, Balaji J, Deokar AA, Vadez V, Xiao Y, Srinivasan R, Gaur PM, Siddique KH, Town CD, Hoisington DA. A comprehensive resource of drought- and salinity- responsive ESTs for gene discovery and marker development in chickpea (Cicer arietinum L.). BMC genomics. 2009; 10:523. |
|
