|
Marker Overview
Name | CISR011 |
Genbank ID | N/A |
Type | CISR |
Species | Cicer sp. |
Primer 1 | CISR011.Forward primer: TTGTCATAGGTTGAGCTTTGTG |
Primer 2 | CISR011.Reverse primer: TTAGATCTCACCGAACGCAA |
Product Length | 553 |
Publication | [view all] |
Publications
Year | Publication |
2011 | Gujaria N, Kumar A, Dauthal P, Dubey A, Hiremath P, Bhanu Prakash A, Farmer A, Bhide M, Shah T, Gaur PM, Upadhyaya HD, Bhatia S, Cook DR, May GD, Varshney RK. Development and use of genic molecular markers (GMMs) for construction of a transcript map of chickpea (Cicer arietinum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2011 May; 122(8):1577-89. |
|