G6P-T, G6P-T (genetic_marker) Cicer sp.

Name	G6P-T
Genbank ID	3413512
Type	gene marker
Species	Cicer sp.
Primer 1	G6P-T.Forward primer: CATATTGCCAAGCACTGGAA
Primer 2	G6P-T.Reverse primer: TGGGACAAGATGGGGAGATA
Max Length	600
Publication	[view all]

Database	Accession
DB:genbank	3413512

Year	Publication
2003	Pfaff T, Kahl G. Mapping of gene-specific markers on the genetic map of chickpea (Cicer arietinum L.). Molecular genetics and genomics : MGG. 2003 May; 269(2):243-51.