GA119, GA119 (genetic_marker) Cicer arietinum

Name	GA119
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(GA)7GAAA(GA)5(GAAA)2(GA)28
Primer 1	GA119.Forward primer: TGAACAAAGAAAAACCCGTTC
Primer 2	GA119.Reverse primer: TGGCAATTTGTCTGAGATGC
Product Length	268
Publication	[view all]

Aligned Feature	Feature Type	Alignment Location
Ca3	chromosome	Ca3:3429675..3429940 .
chr3	chromosome	chr3:3429675..3429940 .

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICCV96029xCDCFrontier-F2	LG3	N/A	139.6	GA119	View
2	chickpea-ILC588xILC3279-RIL	LG3	N/A	94.9	GA119	View
3	chickpea-ICCV96029xCDCFrontier-F2-2007	LG3	N/A	139.6	GA119	View
4	chickpea-ICC3996xILWC184-F2	LG3	N/A	27.8	GA119	View
5	Chickpea-ICC4958× ICC1882-RIL	CaLG03	N/A	50.59	GA119	View
6	Chickpea-RIP5-Ortega	LG03	N/A	0	GA119	View