GA4, GA4 (genetic_marker) Cicer arietinum

Name	GA4
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(GA)9
Primer 1	GA4.Forward primer: TTGCGTGTCAATCTCATTGG
Primer 2	GA4.Reverse primer: TCAACACCCCTAACTCGGAC
Product Length	208
Publication	[view all]

Aligned Feature	Feature Type	Alignment Location
Ca5	chromosome	Ca5:38745590..38745797 .
chr5	chromosome	chr5:38745590..38745797 .

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2012	LG5	N/A	200.5	GA4	View
2	chickpea-ICC4958xPI489777-RIL-2012-2	LG5	N/A	68.5	GA4	View
3	chickpea-ICC4958xPI489777-RIL-F10	LG5	N/A	70.15	GA4	View
4	chickpea-ICC4958xPI489777-RIL-F10-2012	LG05	N/A	66.84	GA4	View
5	chickpea-ICC4958xPI489777-RIL-2010	LG5	N/A	118.8	GA4	View
6	chickpea-ICC4958xPI489777-RIL-2015-2	LG5	N/A	47.54	GA4	View
7	faba-29H_x_Vf136-RIL-2017	LG17+LG7	N/A	106.1	GA4	View
8	Chickpea-Physical_consensus	Ca5	N/A	38745590	GA4	View
9	Chickpea-ICCL81001_x_Cr5-9-RIL	LG5	N/A	143.1	GA4	View
10	faba-ConsensusMap_2013-RIL	LGI	N/A	499.07	GA4	View
11	faba-Vf6xVf136-F6	LGIA	N/A	397.1	GA4	View
12	Chickpea-ICC4958/PI489777-RIL-2020	LG05	N/A	166.52	GA4	View
13	Faba-Vf6/Vf27-RIL	LG01a	N/A	569	GA4	View
14	Faba-Vf6/Vf27-RIL-2021	LG01-1	N/A	625.3	GA4	View
15	Faba-Vf6/Vf27-F8-F9	LGI	N/A	653.01	GA4	View