H2B061, H2B061 (genetic_marker) Cicer arietinum

Marker Overview
NameH2B061
Genbank IDN/A
TypeSSR
SpeciesCicer arietinum
GermplasmHadas
Repeat Motif(GAA)2 G (GAA)19 70 bp (TA)7 14 bp (TA)11
Primer 1H2B061.Forward primer: TCTTGAAGCAAAAGAAGTCAAAAG
Primer 2H2B061.Reverse primer: CAAGTGATAAGTAGGAAGGCAGAA
Product Length163
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
H2B061.Forward primerH2B061.Forward primerCicer arietinumprimer
Reverse primerH2B061.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Fusarium wilt incidenceqFWI.JG62/ICCV05530.LG2.PaCicer arietinumQTL
Fusarium wilt incidenceqFWI.JG62/ICCV05530.LG2.LuCicer arietinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Days to maturityqDM.ILC588xILC3279.LG2.TH-cont09Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
H2B061H2B061Cicer arietinummarker_locus
H2B061H2B061-13.77Cicer arietinummarker_locus


Germplasm
Stock NameType
Hadascultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xILC3279-F2LG2N/A37.4H2B061View
2chickpea-C214xWR315-F2LG2N/A28.5H2B061View
3chickpea-ICC4958xPI489777-RIL-2011LG2N/A58H2B061View
4chickpea-ICC4958xPI489777-RIL-2012LG2N/A79.6H2B061View
5chickpea-ICC4958xPI489777-RIL-2012-2LG2N/A45.6H2B061View
6chickpea-ICC4958xPI489777-RIL-F10LG2N/A51.81H2B061View
7chickpea-HadasxICC5810-RILLG2N/A32.6H2B061View
8chickpea-ICC4958xPI489777-RIL-F10-2012LG02N/A49.99H2B061View
9chickpea-ICC3996xILWC184-F2LG2N/A1H2B061View
10chickpea-ICC4958xPI489777-RIL-2010LG2N/A126.4H2B061View
11chickpea-ICC4958xPI489777-RIL-2015-2LG2N/A67.83H2B061View
12Chickpea-ICC4958× ICC1882-RILCaLG02N/A23.63H2B061View
13Chickpea-RIP5-OrtegaLG02N/A13.5H2B061View
14Chickpea-RIP8-OrtegaLG02-1N/A13.5H2B061View
15Chickpea-ICC4958/PI489777-RIL-2020LG02N/A88.63H2B061View
16Chickpea-JG62/ICCV05530-RILLG02N/A13.77H2B061-13.77View