H4H10, H4H10 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	H4H10
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Germplasm	Hadas
Repeat Motif	(GAT)3 23 bp (GAT)3 T (GAT)3
Primer 1	H4H10.Forward primer: GGCATTGCATTCATAAACAGAA
Primer 2	H4H10.Reverse primer: TTCGTTCAACACCTTTTTCATC
Product Length	200
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
scaffold716	supercontig	scaffold716:235883..236082 .	Cicer arietinum CDC Frontier genome v1.0	PCD marker alignment to genome using primer sequences
scaffold716	chromosome	scaffold716:235883..236082 .	Cicer arietinum CDC Frontier NCBI RefSeq v1	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2005	Lichtenzveig J, Scheuring C, Dodge J, Abbo S, Zhang HB. Construction of BAC and BIBAC libraries and their applications for generation of SSR markers for genome analysis of chickpea, Cicer arietinum L. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(3):492-510.

Germplasm


Stock Name	Type
Hadas	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC3996xILWC184-F2	LG6	N/A	41.7	H4H10	View