ICCeM0039, ICCeM0039 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	ICCeM0039
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Repeat Motif	(GAAAGT)5
Primer 1	ICCeM0039.Forward primer: GAATCCTGTTATGGCGGAGA
Primer 2	ICCeM0039.Reverse primer: GGCGGTGATGATGAAGAAGT
Product Length	252
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Ca6	chromosome	Ca6:55616555..55616806 .
chr6	chromosome	chr6:55616555..55616806 .

Publications


Year	Publication
2009	Varshney RK, Hiremath PJ, Lekha P, Kashiwagi J, Balaji J, Deokar AA, Vadez V, Xiao Y, Srinivasan R, Gaur PM, Siddique KH, Town CD, Hoisington DA. A comprehensive resource of drought- and salinity- responsive ESTs for gene discovery and marker development in chickpea (Cicer arietinum L.). BMC genomics. 2009; 10:523.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2011	LG6	N/A	68	ICCeM0039	View
2	chickpea-ICC4958xPI489777-RIL-F10	LG6	N/A	73.15	ICCeM0039	View
3	chickpea-ICC4958xPI489777-RIL-F10-2012	LG06	N/A	48.29	ICCeM0039	View