|
Marker Overview
Name | ICCM0082 |
Genbank ID | FI856833 |
Type | SSR |
Species | Cicer arietinum |
Germplasm | ICC4958 |
Repeat Motif | (CT)19N(TC)4 |
Primer 1 | ICCM0082.Forward primer: TCACGATCTCACAGAGCCAC |
Primer 2 | ICCM0082.Reverse primer: TCCGTGATTCTGAGCAACAG |
Product Length | 260 |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | FI856833 |
Publications
Year | Publication |
2010 | Nayak SN, Zhu H, Varghese N, Datta S, Choi H, Horres R, Jüngling R, Singh J, Kavi Kishor PB, Sivaramakrishnan S, Hoisington DA, Kahl G, Winter P, Cook DR, Varshney RK. Integration of novel SSR and gene-based SNP marker loci in the chickpea genetic map and establishment of new anchor points with Medicago truncatula genome. Theoretical and applied genetics TAG. 2010; 120(7):1415-1441. |
|