NCPGR30, NCPGR30 (genetic_marker) Cicer arietinum

Name	NCPGR30
Genbank ID	AY446332
Type	STMS
Species	Cicer arietinum
Germplasm	Pusa362
Repeat Motif	(CA)14(CGCA)3(CA)2N58(CA)10
Primer 1	NCPGR30.Forward primer: GGCAATGAGCAACTTTTCCT
Primer 2	NCPGR30.Reverse primer: GCTTTGAAAAACGGGGTGT
Product Length	173
Publication	[view all]
Contact	Vincent Vadez

Name	Details
Vincent Vadez	First name: Vincent Last name: Vadez Title: Researcher Institution: International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) Address: International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, Andhra Pradesh 502 324, India Country: India Email: v.vadez@cgiar.org

Database	Accession
DB:genbank	AY446332

Year	Publication
2006	Sethy NK, Shokeen B, Edwards KJ, Bhatia S. Development of microsatellite markers and analysis of intraspecific genetic variability in chickpea (Cicer arietinum L.). Theor Appl Genet. 2006; 112:1416-1428.
2018	Sivasakthi K, Thudi M, Tharanya M, Kale SM, Kholová J, Halime MH, Jaganathan D, Baddam R, Thirunalasundari T, Gaur PM, Varshney RK, Vadez V. Plant vigour QTLs co-map with an earlier reported QTL hotspot for drought tolerance while water saving QTLs map in other regions of the chickpea genome. BMC plant biology. 2018 Feb 06; 18(1):29.

Stock Name	Type
Pusa362	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Chickpea-ICC4958_x_ICC1882-RIL-2018	CaLG04	N/A	42.14	NCPGR30	View
2	Chickpea-ICC4958× ICC1882-RIL	CaLG04	N/A	55.55	NCPGR30	View