RGA01, RGA01 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	RGA01
Genbank ID	N/A
Type	CAPS
Species	Cicer sp.
Primer 1	RGA01.Forward primer: ACCCTTGCACAACTTGTTTAC
Primer 2	RGA01.Reverse primer: GCAATCCTCCACACTTTCTTG
Product Length	511
Restriction Enzyme	RsaI
Publication	[view all]
Comment	C. arietinum; C. reticulatum

Publications


Year	Publication
2009	Palomino C, Fernandez-Romero MD, Rubio J, Torres A, Moreno MT, Millan T. Integration of new CAPS and dCAPS-RGA markers into a composite chickpea genetic map and their association with disease resistance. Theor Appl Genet. 2009; 118:671-682.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	faba-ConsensusMap_2013-RIL	LGIIa	N/A	86.87	RGA01	View
2	Chickpea-RIP12-Ortega	LG05	N/A	4.8	RGA01	View
3	Faba-Vf6_x_Vf136-F6-RIL-2021	CHR2	N/A	14.6	RGA01	View