TA135, TA135 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	TA135
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(TAA)17
Primer 1	TA135.Forward primer: TGGTTGGAAATTGATGTTTT
Primer 2	TA135.Reverse primer: GTGGTGTGAGCATAATTCAA
Product Length	192
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Ca3	chromosome	Ca3:17318484..17318675 .
chr3	chromosome	chr3:17318484..17318675 .

Publications


Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.

Germplasm


Stock Name	Type
ILC3279	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-JG62xVijay-RIL-2011	LG2	N/A	48.5	TA135	View
2	chickpea-JG62xVijay-VijayxICC4958-RIL	LG1	N/A	91.2	TA135	View
3	chickpea-ICC4958xPI489777-RIL-2011	LG3	N/A	1.3	TA135	View
4	chickpea-ICC4958xPI489777-RIL-2012	LG3	N/A	129.1	TA135	View
5	chickpea-ICC4958xPI489777-RIL-2012-2	LG3	N/A	108.1	TA135	View
6	chickpea-HadasxCr205-F2	LG3B	N/A	1.2	TA135	View
7	chickpea-ICC4958xPI489777-RIL-F10-2012	LG03	N/A	37.31	TA135	View
8	chickpea-ICC12004xLasseter-F2	LGI	N/A	187.7	TA135	View
9	chickpea-ICC3996xILWC184-F2	LG3	N/A	31.1	TA135	View
10	chickpea-LasseterxICC3996-F6-RIL	LG3	N/A	0	TA135	View
11	chickpea-S95362xHowzat-F6-RIL	LG3	N/A	4.7	TA135	View
12	chickpea-ICC4958xPI489777-RIL-2010	LG3	N/A	60.2	TA135	View
13	chickpea-ICC4958xPI489777-RIL-2015-2	LG3	N/A	48.85	TA135	View
14	Chickpea-RIP8-Ortega	LG03-2	N/A	22.7	TA135	View
15	Chickpea-ICC4958/PI489777-RIL-2020	LG03	N/A	129.73	TA135	View