|
|
Marker Overview
| Name | TA27 |
|---|
| Genbank ID | N/A |
|---|
| Type | STMS |
|---|
| Species | Cicer arietinum |
|---|
| Germplasm | ILC3279 |
|---|
| Repeat Motif | (TAA)21 |
|---|
| Primer 1 | TA27.Forward primer: GATAAAATCATTATTGGGTGTCCTTT |
|---|
| Primer 2 | TA27.Reverse primer: TTCAAATAATCTTTCATCAGTCAAATG |
|---|
| Product Length | 241 |
|---|
| Publication | [view all] |
|---|
Alignments
The following features are aligned
Publications
| Year | Publication |
|---|
| 1999 | Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101. |
| 2013 | Sabbavarapu MM, Sharma M, Chamarthi SK, Swapna N, Rathore A, Thudi M, Gaur PM, Pande S, Singh S, Kaur L, Varshney RK. Molecular mapping of QTLs for resistance to Fusarium wilt (race 1) and Ascochyta blight in chickpea (Cicer arietinum L.). Euphytica. 2013; 193(1):121-133. |
| 2014 | Patil B, Ravikumar R, Bhat J, Soregaon C. Molecular mapping of QTLs for resistance to early and late Fusarium wilt in chickpea. Czech journal of genetics and plant breeding. 2014; 50(2):171-176. |
|
