TA44, TA44 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	TA44
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(TAA)16
Primer 1	TA44.Forward primer: ACCGAAATGGAAACAAATAA
Primer 2	TA44.Reverse primer: ACAAAACTGGGGGACTAAAT
Product Length	193
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Ca7	chromosome	Ca7:11840265..11840457 .

Publications


Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.

Germplasm


Stock Name	Type
ILC3279	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICCV2xJG62-F10-RIL	LG6A	N/A	42	TA44	View
2	chickpea-ICCV2xJG62-RIL	LG3	N/A	96	TA44	View
3	chickpea-ICCV96029xCDCFrontier-F2	LG7	N/A	196	TA44	View
4	chickpea-ILC3279xICCV2-F3	LG7	N/A	52.5	TA44	View
5	chickpea-ICCV96029xCDCFrontier-F2-2007	LG7	N/A	196	TA44	View
6	chickpea-HadasxCr205-F2	LG7B	N/A	24	TA44	View
7	chickpea-ICC3996xILWC184-F2	LG7	N/A	29.5	TA44	View
8	chickpea-LasseterxICC3996-F6-RIL	LG7.1	N/A	47.5	TA44	View
9	chickpea-S95362xHowzat-F6-RIL	LG7	N/A	56.1	TA44	View
10	chickpea-ILC588xILC3279-RIL-F6	LG7	N/A	0	TA44	View
11	Chickpea-JG62/ICCV05530-RIL	LG07	N/A	0	TA44	View