TC88726, TC88726 (genetic_marker) Cicer sp. | PulseDB

Marker Overview

Marker Overview


Name	TC88726
Genbank ID	TC88726
Type	SNAP
Species	Cicer sp.
Primer 1	TC88726.Forward primer: GAGGAGAATACGCCATCCAA
Primer 2	TC88726.Reverse primer: GGATAGTGTGGGCTGCATCT
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	TC88726

Publications


Year	Publication
2010	Nayak SN, Zhu H, Varghese N, Datta S, Choi H, Horres R, Jüngling R, Singh J, Kavi Kishor PB, Sivaramakrishnan S, Hoisington DA, Kahl G, Winter P, Cook DR, Varshney RK. Integration of novel SSR and gene-based SNP marker loci in the chickpea genetic map and establishment of new anchor points with Medicago truncatula genome. Theoretical and applied genetics TAG. 2010; 120(7):1415-1441.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2011	LG3	N/A	7.9	TC88726	View
2	chickpea-ICC4958xPI489777-RIL-F10	LG3	N/A	26.2	TC88726	View
3	chickpea-ICC4958xPI489777-RIL-F10-2012	LG03	N/A	42.92	TC88726	View
4	chickpea-ICC4958xPI489777-RIL-2010	LG3	N/A	93.5	TC88726	View