TCMO, TCMO (genetic_marker) Cicer sp.

Marker Overview
NameTCMO
Genbank IDAW127521
TypeCAPS
SpeciesCicer sp.
Primer 1TCMO.Forward primer: GTCTACGGCGAACATTGGCGTAAAATGC
Primer 2TCMO.Reverse primer: CAATTGCAGCAACATTGATGTTCTCAACA
Restriction EnzymeHph I
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAW127521
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTCMO.Forward primerCicer sp.primer
Reverse primerTCMO.Reverse primerCicer sp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TCMOTCMOCicer sp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Lupin-Kiev_Mutant/P27174-RIL-2013LG11-2N/A18.4TCMOView
2chickpea-ICC4958xPI489777-RIL-2011LG5N/A71.5TCMOView
3chickpea-ICC4958xPI489777-RIL-F10LG5N/A77.54TCMOView
4chickpea-ICC4958xPI489777-RIL-F10-2012LG05N/A75.02TCMOView
5chickpea-ICC4958xPI489777-RIL-2010LG5N/A136.7TCMOView
6Pea-Attika_x_Isard-RIL-2016LGIN/A76.9TCMOView
7Pea-Kaspa_x_Attika-RIL-2016LGIN/A42TCMOView
8Pea-Consensus_RIL-2016LGIN/A58.1TCMOView