TR19, TR19 (genetic_marker) Cicer arietinum

Marker Overview
Genbank IDN/A
SpeciesCicer arietinum
Repeat Motif(TAA)27
Primer 1TR19.Forward primer: TCAGTATCACGTGTAATTCGT
Primer 2TR19.Reverse primer: CATGAACATCAAGTTCTCCA
Product Length227
Publication[view all]

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TR19.Forward primerTR19.Forward primerCicer arietinumprimer
Reverse primerTR19.Reverse primerCicer arietinumprimer

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Seed colorqSDCL.ICC3996xS95362.LG2.H.CIE_bCicer arietinumQTL
Seed colorqSDCL.ICC3996xS95362.LG2.M.CIE_bCicer arietinumQTL
Seed colorqSDCL.ICC3996xS95362.LG2.H.CCicer arietinumQTL
Seed colorqSDCL.ICC3996xS95362.LG2.M.CCicer arietinumQTL
Fusarium wilt incidenceqFWI.JG62/ICCV05530.LG2.PaCicer arietinumQTL
Fusarium wilt incidenceqFWI.JG62/ICCV05530.LG2.LuCicer arietinumQTL

This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.ICCV96029xCDCLuna.LG2Cicer arietinumQTL

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TR19TR19Cicer arietinummarker_locus
TR19TR19-8.3Cicer arietinummarker_locus

Stock NameType
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer