TR19, TR19 (genetic_marker) Cicer arietinum

Marker Overview
NameTR19
AliasTR19s
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)27
Primer 1TR19.Forward primer: TCAGTATCACGTGTAATTCGT
Primer 2TR19.Reverse primer: CATGAACATCAAGTTCTCCA
Product Length227
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TR19.Forward primerTR19.Forward primerCicer arietinumprimer
Reverse primerTR19.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Seed colorqSDCL.ICC3996xS95362.LG2.H.CIE_bCicer arietinumQTL
Seed colorqSDCL.ICC3996xS95362.LG2.M.CIE_bCicer arietinumQTL
Seed colorqSDCL.ICC3996xS95362.LG2.H.CCicer arietinumQTL
Seed colorqSDCL.ICC3996xS95362.LG2.M.CCicer arietinumQTL
Fusarium wilt incidenceqFWI.JG62/ICCV05530.LG2.PaCicer arietinumQTL
Fusarium wilt incidenceqFWI.JG62/ICCV05530.LG2.LuCicer arietinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.ICCV96029xCDCLuna.LG2Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TR19TR19Cicer arietinummarker_locus
TR19TR19-8.3Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xILC3279-F2LG2N/A30.6TR19View
2chickpea-C214xWR315-F2LG2N/A23.8TR19View
3chickpea-ICC4991xICCV04516-F2LG2N/A0TR19View
4chickpea-ICCV96029xAmit-F2LG2N/A0TR19View
5chickpea-ICCV96029xCDCCorinne-F2LG2N/A38.7TR19View
6chickpea-ICCV96029xCDCFrontier-F2LG2N/A45.4TR19View
7chickpea-ICCV96029xCDCLuna-F2LG2N/A10.7TR19View
8chickpea-ILC3279xICCV2-F3LG2N/A25.7TR19View
9chickpea-JG62xVijay-RIL-2011LG5N/A62.7TR19View
10chickpea-JG62xVijay-VijayxICC4958-RILLG3N/A39TR19View
11chickpea-ICC4958xPI489777-RIL-2011LG2N/A34.9TR19View
12chickpea-ICC4958xPI489777-RIL-2012LG2N/A49.5TR19View
13chickpea-ICCV96029xCDCFrontier-F2-2007LG2N/A45.4TR19View
14chickpea-HadasxICC5810-RILLG2N/A13.7TR19View
15chickpea-ILC3279xWR315-RIL-2007LG2N/A36.7TR19View
16chickpea-ICC4958xPI489777-RIL-F10-2012LG02N/A30.03TR19View
17chickpea-ICC12004xLasseter-F2LGIN/A30.8TR19View
18chickpea-ILC588xILC3279-RIL-F6LG2N/A3.2TR19View
19chickpea-ICC4958xPI489777-RIL-2010LG2N/A38.3TR19View
20chickpea-ICC4958xPI489777-RIL-2015-2LG2N/A36.33TR19View
21chickpea-ICCV96029×CDCFrontier-F2-2017CaLG02N/A0TR19View
22chickpea-ICC5810×CDCFrontier-F2-2017CaLG02N/A20.9TR19View
23chickpea-BGD132×CDCFrontier-F2-2017CaLG02N/A0TR19View
24chickpea-flowering_time_consensus_map-F2-2017CaLG02N/A23.4TR19View
25Chickpea-ICCL81001_x_Cr5-9-RILLG2N/A26.4TR19View
26Chickpea-JG62_X_WR315-RILLG2N/A0TR19View
27Chickpea-RIP12-OrtegaLG02N/A11.5TR19View
28Chickpea-RIP5-OrtegaLG02N/A10.3TR19View
29Chickpea-RIP8-OrtegaLG02-1N/A16TR19View
30Chickpea-JG62/ICCV05530-RILLG02N/A8.3TR19-8.3View