|
|
Marker Overview
| Name | TS57 |
|---|
| Genbank ID | N/A |
|---|
| Type | STMS |
|---|
| Species | Cicer arietinum |
|---|
| Germplasm | ILC3279 |
|---|
| Repeat Motif | (TA)9; (AAT)23CNT(AAT)13 |
|---|
| Primer 1 | TS57.Forward primer: TCAATTTATAATCATAGAGAATCNGAGA |
|---|
| Primer 2 | TS57.Reverse primer: CCTAAAACAAATAAAATCTTAAATAATA |
|---|
| Product Length | 321 |
|---|
| Publication | [view all] |
|---|
| Contact | Vincent Vadez
|
|---|
Publications
| Year | Publication |
|---|
| 1999 | Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101. |
| 2018 | Sivasakthi K, Thudi M, Tharanya M, Kale SM, Kholová J, Halime MH, Jaganathan D, Baddam R, Thirunalasundari T, Gaur PM, Varshney RK, Vadez V. Plant vigour QTLs co-map with an earlier reported QTL hotspot for drought tolerance while water saving QTLs map in other regions of the chickpea genome. BMC plant biology. 2018 Feb 06; 18(1):29. |
|
