|
|
Marker Overview
| Name | AA484 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Pisum sativum |
|---|
| Primer 1 | AA484.Forward Primer: aatggtgacgaatacaccgcta |
|---|
| Primer 2 | AA484.Reverse Primer: cttcaaacttgttgcatgcctt |
|---|
| Publication | [view all] |
|---|
| Comment | Agrogène; PSMPS prefix for marker |
|---|
Publications
| Year | Publication |
|---|
| 2005 | Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31. |
| 2015 | Jain S, Weeden NF, Kumar A, Chittem K, McPhee K. Functional Codominant Marker for Selecting the Fw Gene Conferring Resistance to Fusarium Wilt Race 1 in Pea. 2015; 55(6):2639-2646. |
|
