AA94, AA94 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AA94
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AA94.Forward Primer: tgaagacccacttgcatgaag
Primer 2	AA94.Reverse Primer: agcccacacaggtggtttta
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr4LG4	supercontig	chr4LG4:179983620..179984015 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-ShawneexBohatyr-RIL	LGIVb.3	N/A	69	AA94-394	View
2	pea-microsatComposite-2005	LGIV	N/A	95.7	AA94_394	View
3	pea-ShawneexBohatyr-F7-RIL	LGIV	N/A	109.2	AA94_394	View
4	pea-DSPx90-2131-RIL-2015	LGIIIA	N/A	65.5	PSAA94b	View