AD230, AD230 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AD230
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AD230.Forward Primer: gcgattctagaaagtgaaaaca
Primer 2	AD230.Reverse Primer: cattgaagagtggattaagcat
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
chr6LG2	supercontig	chr6LG2:415726684..415726865 .	Pisum sativum Cameor genome v1a	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-ShawneexBohatyr-RIL	LGIIa.3	N/A	21.4	AD230-240	View
2	pea-microsatComposite-2005	LGII	N/A	17.9	AD230-240	View
3	pea-ShawneexBohatyr-RIL	LGVI.3	N/A	0	AD230-135	View
4	pea-microsatComposite-2005	LGVI	N/A	5.5	AD230-135	View
5	pea-PennantxPI595933-F2	LG2	N/A	132.4	AD230	View