|
Marker Overview
Name | eEF1Bb |
Genbank ID | AY444796 |
Type | SSCP |
Species | Pisum sativum |
Primer 1 | eEF1Bb.Forward Primer: hCAGCTTTGTCATCAGTTCCATC |
Primer 2 | eEF1Bb.Reverse Primer: AGTGGCAACAGCCTCTTCAG |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | AY444796 |
Publications
Year | Publication |
2006 | Aubert G, Morin J, Jacquin F, Loridon K, Quillet M, Petit A, Rameau C, Lejeune-Hénaut I, Huguet T, Burstin J. Functional mapping in pea, as an aid to the candidate gene selection and for investigating synteny with the model legume Medicago truncatula. Theoretical and applied genetics. 2006; 112(6):1024-1041. |
2014 | Duarte J, Riviere N, Barabger A, Aubert G, Burstin J, Cornet L, Lavaud C, Lejeune-Henaut I, Martinant JP, Pichon JP, Pilet-Nayel ML, Boutet G. Transcriptome sequencing for high throughput SNP development and genetic mapping in Pea. BMC Genomics. 2014; 15:126. |
|