|
|
Marker Overview
| Name | Ho1 |
|---|
| Genbank ID | AF276230 |
|---|
| Type | CAPS |
|---|
| Species | Pisum sativum |
|---|
| Primer 1 | Ho1.Forward Primer: GAAGATTGTTCAAGATGCTGC |
|---|
| Primer 2 | Ho1.Reverse Primer: TCAGTTTGTCTCTCACGTTCTG |
|---|
| Product Length | 1850 |
|---|
| Restriction Enzyme | HpaII |
|---|
| Publication | [view all] |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | AF276230 |
Publications
| Year | Publication |
|---|
| 2009 | Konovalov FA, Toshchakova EA, Gostimskiĭ SA. CAPS markers for the identification of garden pea (Pisum sativum L.) cultivars. Journal of Russian Genetics 2009; 45(2):251-254. |
| 2016 | Ferrari B., Romani M., Aubert G., Boucherot K., Burstin J., Pecetti L., Huart-Naudet M., Klein A., Annicchiarico P. . Association of SNP Markers with Agronomic and Quality Traits of Field Pea in Italy. Czech Journal of Genetics and Plant Breeding. 2016; 52(3):83-93. |
|
