Lb5-10_SNP1, Lb5-10_SNP1 (genetic_marker) Pisum sativum

Marker Overview
NameLb5-10_SNP1
AliasLb5-10
Lb5_10
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
5' Flanking SequenceGAAAACATGTTTGGTTNGTTTTGATAAAAGTATACTCGAGAAAGCACCTGCAGCTAAGGG
3' Flanking SequenceTTATTCTCTTTTCTTAAAGACACAGCTGGAGTAGAGGATAGTCCTAAACTTCAAGCCCAT
SpeciesPisum sativum
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAB010831
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Lb5-10_SNP1Lb5-10_SNP1Pisum sativummarker_locus
Lb5_10Lb5_10Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-P665/Messire-F8:9-RILLG07N/A185.51Lb5-10_SNP1View
2pea-consensusMap-2011LGIN/A84.7Lb5_10View
3Pea-Kaspa_x_Attika-RIL-2016LGIN/A70.9Lb5_10View
4Pea-Kaspa_x_Isard-RIL-2016LGIN/A72.7Lb5_10View
5Pea-Consensus_RIL-2016LGIN/A86.5Lb5_10View
Sequence
>Lb5-10_SNP1 ID=Lb5-10_SNP1|Name=Lb5-10_SNP1|organism=Pisum sativum|type=genetic_marker|length=121bp
GAAAACATGTTTGGTTNGTTTTGATAAAAGTATACTCGAGAAAGCACCTG
CAGCTAAGGGYTTATTCTCTTTTCTTAAAGACACAGCTGGAGTAGAGGAT
AGTCCTAAACTTCAAGCCCAT