MitCySyn, MitCySyn (genetic_marker) Pisum sativum

Marker Overview
NameMitCySyn
Genbank IDCD860277
TypedCAPS
SpeciesPisum sativum
Primer 1MitCySyn.Forward Primer: CACGACGTTGTAAAACGACCTCTGTAGACTTAATGG
Primer 2MitCySyn.Reverse Primer: CCAGACAATTCCTGTGTTCCCAC
Restriction EnzymeMaeI
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCD860277
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerMitCySyn.Forward PrimerPisum sativumprimer
Reverse PrimerMitCySyn.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MitCySynMitCySynPisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-consensusMap-2011LGVIIN/A83.8MitCySynView