PEAPHTAP, PEAPHTAP (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	PEAPHTAP
Genbank ID	M37217
Type	SSR
Species	Pisum sativum
Repeat Motif	(AAT)4
Primer 1	PEAPHTAP.Forward Primer: tggattggattggatgatga
Primer 2	PEAPHTAP.Reverse Primer: tggagcccttagtccacaac
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	M37217

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
chr6LG2	supercontig	chr6LG2:303808953..303809171 .	Pisum sativum Cameor genome v1a	PCD marker alignment to genome using primer sequences
Lcu.2RBY.Chr1	supercontig	Lcu.2RBY.Chr1:420074010..420074188 .	Lens culinaris CDC Redberry genome v2.0	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2001	Burstin J, Deniot G, Potier J, Weinachter C, Aubert G, Baranger A. Microsatellite polymorphism in Pisum sativum. Plant breeding = Zeitschrift für Pflanzenzüchtung. 2001 Aug; 120(4):311-317.