|
Marker Overview
Name | Peaβglu |
Genbank ID | L02212 |
Type | CAPS |
Species | Pisum sativum |
Primer 1 | Peaβglu.Forward Primer: AAACAACCTACCACCAGCAAA |
Primer 2 | Peaβglu.Reverse Primer: AAACAACAACATTCACCCAACC |
Product Length | 686 |
Restriction Enzyme | Tfi1 |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | L02212 |
Publications
Year | Publication |
2007 | Prioul-Gervais S, Deniot G, Receveur EM, Frankewitz A, Fourmann M, Rameau C, Pilet-Nayel ML, Baranger A. Candidate genes for quantitative resistance to Mycosphaerella pinodes in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2007 Apr; 114(6):971-84. |
2013 | Satovic Z, Avila CM, Cruz-Izquierdo S, Diaz-Ruiz R, Garcia-Ruiz M, Palomino C, Gutierrez N, Vitale S, Ocana-Moral S, Gutierrez MV, Cubero JI, Torres AM. A reference consensus genetic map for molecular markers and economically important traits in faba bean (Vicia faba L.). 2013; 14:932. |
|