|
|
Marker Overview
| Name | Peroxid |
|---|
| Genbank ID | N/A |
|---|
| Type | Indel |
|---|
| Species | Medicago truncatula |
|---|
| Primer 1 | Peroxid.Forward Primer: TCTTGCTATGGCAACTCGTG |
|---|
| Primer 2 | Peroxid.Reverse Primer: GTTGAATCCAGGCTCAGGAA |
|---|
| Publication | [view all] |
|---|
Publications
| Year | Publication |
|---|
| 2011 | Bordat A, Savois V, Nicolas M, Salse J, Chauveau A, Bourgeois M, Potier J, Houtin H, Rond C, Murat F, Marget P, Aubert G, Burstin J. Translational Genomics in Legumes Allowed Placing In Silico 5460 Unigenes on the Pea Functional Map and Identified Candidate Genes in Pisum sativum L. G3 (Bethesda, Md.). 2011 Jul; 1(2):93-103. |
|
