PsC18033p149, PsC18033p149 (genetic_marker) Pisum sativum

Marker Overview
NamePsC18033p149
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
5' Flanking SequenceCTTCCTCAGAGTGACCTTGGCGCAGAAGCGGTTTGTTGCAGGGCCTTTCAACTTGGGTCG
3' Flanking SequenceTACGGARTCGTTGTTGGTTGGATTTCAGTTATTTGGGTGGCAACAATCTCTATACTATTC
SpeciesPisum sativum
Publication[view all]
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsC18033p149PsC18033p149Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-consensusMap-2014LGIIN/A78PsC18033p149View
2Pea-Integrated_Map-Sudheesh-2015LG2N/A360.45PsC18033p149View
3Pea_P651_x_Alfetta_RILLGIIN/A4.5PsC18033p149View
Sequence
>PsC18033p149 ID=PsC18033p149|Name=PsC18033p149|organism=Pisum sativum|type=genetic_marker|length=121bp
CTTCCTCAGAGTGACCTTGGCGCAGAAGCGGTTTGTTGCAGGGCCTTTCA
ACTTGGGTCGWTACGGARTCGTTGTTGGTTGGATTTCAGTTATTTGGGTG
GCAACAATCTCTATACTATTC