RNApol2, RNApol2 (genetic_marker) Medicago truncatula | PulseDB

Marker Overview

Marker Overview


Name	RNApol2
Genbank ID	TC101427
Type	Indel
Species	Medicago truncatula
Primer 1	RNApol2.Forward Primer: GTGTATCATGGGGAAGGTGG
Primer 2	RNApol2.Reverse Primer: TCAAAACCACGCATTTGGTA
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	TC101427

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Ca4	chromosome	Ca4:48262861..48263326 .	Cicer arietinum CDC Frontier genome v1.0	PCD marker alignment to genome using primer sequences
chr4	chromosome	chr4:48262861..48263326 .	Cicer arietinum CDC Frontier NCBI RefSeq v1	PCD marker alignment to genome using primer sequences
Chr_8-CM003610.1	supercontig	Chr_8-CM003610.1:17555878..17556402 .	Cajanus cajan Asha genome v1.0	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2011	Bordat A, Savois V, Nicolas M, Salse J, Chauveau A, Bourgeois M, Potier J, Houtin H, Rond C, Murat F, Marget P, Aubert G, Burstin J. Translational Genomics in Legumes Allowed Placing In Silico 5460 Unigenes on the Pea Functional Map and Identified Candidate Genes in Pisum sativum L. G3 (Bethesda, Md.). 2011 Jul; 1(2):93-103.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-consensusMap-2011	LGII	N/A	0.8	RNApol2	View