SNP_100000600, SNP_100000600 (genetic_marker) Pisum sativum

Marker Overview
NameSNP_100000600
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
5' Flanking SequenceTTGTGGGTTTAGAAATGGAAGACTTGTTTGAAAGAGAGAAAAGATGTGAAAGAAAGAGTA GTGAACAATGAATGAAAAGGGATGAGAATATATAAAAAGA
3' Flanking SequenceAGGGTAAGGTTTAGAAGTGGGGGACTTGAAACAAAGAAGTGGAAGGACAGCTATTAAGGC
SpeciesPisum sativum
Publication[view all]
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_100000600SNP_100000600Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-KaspaxParafield-RILLGIN/A135.5SNP_100000600View
2Pea-Integrated_Map-Sudheesh-2015LG1N/A170.06SNP_100000600View
3Pea-Composite_Map-Sudheesh-2015LG1N/A178.88SNP_100000600View
4Pea-Kaspa_x_PBA Oura-RILLG1N/A70.3SNP_100000600View
Sequence
>SNP_100000600 ID=SNP_100000600|Name=SNP_100000600|organism=Pisum sativum|type=genetic_marker|length=161bp
TTGTGGGTTTAGAAATGGAAGACTTGTTTGAAAGAGAGAAAAGATGTGAA
AGAAAGAGTAGTGAACAATGAATGAAAAGGGATGAGAATATATAAAAAGA
RAGGGTAAGGTTTAGAAGTGGGGGACTTGAAACAAAGAAGTGGAAGGACA
GCTATTAAGGC