TC100044, TC100044 (genetic_marker) Medicago truncatula | PulseDB

Marker Overview

Marker Overview


Name	TC100044
Genbank ID	TC100044
Type	CAPS
Species	Medicago truncatula
Primer 1	TC100044.Forward Primer: AGGACATTTGCAGCTCTTGGA
Primer 2	TC100044.Reverse Primer: AGGCCTTGTATTTGCAGGAGT
Restriction Enzyme	ClaI
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	TC100044

Publications


Year	Publication
2011	Bordat A, Savois V, Nicolas M, Salse J, Chauveau A, Bourgeois M, Potier J, Houtin H, Rond C, Murat F, Marget P, Aubert G, Burstin J. Translational Genomics in Legumes Allowed Placing In Silico 5460 Unigenes on the Pea Functional Map and Identified Candidate Genes in Pisum sativum L. G3 (Bethesda, Md.). 2011 Jul; 1(2):93-103.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-consensusMap-2011	LGVII	N/A	86.4	TC100044	View