TE002L09, TE002L09 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	TE002L09
Genbank ID	CD860523
Type	SSCP
Species	Pisum sativum
Primer 1	TE002L09.Forward Primer: hAACGGCCACTTCTCCAATC
Primer 2	TE002L09.Reverse Primer: TCAACACCACCAACACGAAC
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	CD860523

Publications


Year	Publication
2006	Aubert G, Morin J, Jacquin F, Loridon K, Quillet M, Petit A, Rameau C, Lejeune-Hénaut I, Huguet T, Burstin J. Functional mapping in pea, as an aid to the candidate gene selection and for investigating synteny with the model legume Medicago truncatula. Theoretical and applied genetics. 2006; 112(6):1024-1041.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGIII	N/A	167.3	TE002L09	View
2	pea-consensusMap-2011	LGIII	N/A	132.8	TE002L09	View